elizaamath5355 elizaamath5355
  • 29-04-2018
  • Chemistry
contestada

Write the correct formula for the compound formed between beryllium and nirtrogen

Respuesta :

mkryukova19 mkryukova19
  • 29-04-2018
Beryllium -second group can form only ion Be²⁺
Nitrogen - 5th group, we need negative ion (8-5 =3 e⁻ can N accept)

Be²⁺N³⁻ ------> Be3N2

Answer Be3N2

Answer Link

Otras preguntas

What is an aesthetic distance?
In choosing a career, your personal resources are defined as _____. a. the amount of money you require to accept the job when first hired b. who you are and wha
Clara's total score for 3 games of bowling is 312. If Clara earned the same score for each game, what was her score for each game.
ce a lucrat SPIRIDON VANGHELI ?
Just a few hours after the birth of a baby, the mammary glands start producing milk. Which hormone stimulates this event? Prolactin Estrogen Progesterone
I need help as soon as possible with the problem bellowSimplify each of the following with justifications for your answer: a. 290 mod 26 b. 9^{-1} mod 26 c. -1
What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT
What number is 120% of 70
Why was george washington concidered the father of our country
is this phrase an hyperbole?: "With torn and bleeding hearts we smile".