ticcitobyproxygirl ticcitobyproxygirl
  • 27-03-2017
  • Spanish
contestada

Marisela: Fue un loro muy bonito. Y gritaba _______________.

Respuesta :

nhithaohien nhithaohien
  • 27-03-2017
Marisela: Fue un loro muy bonito. Y gritaba _mucho_______
Answer Link
drea34 drea34
  • 28-03-2017
Mucho is the answer :)
Answer Link

Otras preguntas

what is 6.25 as a fraction?
Where is the 2006 film pans labyrinth set?
What were Picasso's probable motives for painting Guernica?
What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT
Whoever has a good enough heart to answer these 10 questions will recieve 25 points(Please Only answer if you have read A Seperate Peace) What does Finny reveal
Explain in terms of stracture why metals are malleable?
Which of the following sentences is a declarative sentence? What will they think of next? We live in an amazing time. I simply adore cheese! Please tidy your r
Liquids are similar to gases in that they both have A. a definite volume. B. no definite shape. C. no definite volume. D. particles that remain in contact with
The brain and spinal cord are covered by A. synovial membranes. B. visceral membranes. C. meninges. D. cerebrospinal fluids.
0.4 7. If is what is the full cost