katienosan21 katienosan21

30-11-2022
Mathematics

contestada

PLSSS HURRYYYY!!! 30 POINTS!
The slopes of the sides of quadrilateral JKLM are: 3,-3,, and -3.

Respuesta :

Otras preguntas

How many electrons does chlorine need to gain in order to be like Argon ? - 2 electrons - 3 electrons - 1 electron

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Select the correct answer from each drop-down menu. Angie goes diving in the sea. 1 -Anguilliformes Perciformes Gadiformes 2-salmoniformes Clupeiformes Sphenis

Suppose the sample space for a probability experiment has 48 elements. If items from the sample space are selected without replacement, how many different ways

Use the excerpt from The Fundamental Orders of Connecticut to answer the question.5. The ideas expressed in the excerpt illustrate A. how individualism influenc

If you were traveling 60 mph and not wearing a seatbelt and collided with a fixed object, how fast would you be traveling when you hit the windshield

The imagery in these lines evokes a sense of laziness. Fear. Mystery. Despair.

PLSSS help now!!!!!! Will mark Brainlyest !!!

An mg2+ ion has the same electron configuration as.

Ms. jones is 50bls over weight. she decided to follow a diet to lose 50% of her excess weight by the first month, 20% by the end of second month and 25% more by