cdxxc3434 cdxxc3434

27-12-2021
Biology

contestada

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Respuesta :

taylor11152 taylor11152

27-12-2021

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

Answer Link

Otras preguntas

describe procedure on how Elianto oil can be extracted from maize seeds

Is a macro a type of SD card?

please I need help on question 4

redrock inc. is a household products firm that is considering developing a new detergent. in evaluating whether to go ahead with the new detergent project, whic

the doctrine that every object and event in the world is physical, so mental states must be physical states or somehow reducible to physical states.

you place an egg (a type of cell) that has an ion concentration of 5 mg/l into a beaker of salt water that has an ion concentration of 10 mg/l.

The tree diagram represents an experiment consisting of two trials.

Found was an with the o point out allow a out blinking. of settling estate a = this that also saw it as he country to o wou 1. Which of the following statements

your collection of multiple investments in different assets chosen to meet your financial goals is your

list the angles of def in order from smallest to largest 20 35 50