Chrisitnew1997 Chrisitnew1997
  • 31-01-2017
  • Social Studies
contestada

Which program provides financial protection for retiring workers?

Respuesta :

getttingitdone getttingitdone
  • 31-01-2017
Social Security retirement benefits. 
Answer Link
Zekezz17
Zekezz17 Zekezz17
  • 03-02-2017
Social Security.
Give me stars if it is right.
I hope i answered in time.  :)
Answer Link

Otras preguntas

Will give brainliest please help asap
What was the main reason for France's interest in the New World? They wanted to set up prison colonies. They wanted to obtain furs. They wanted to convert the n
Graph. f(x)=|2x-6|+3
Which two solutions, when mixed together, will undergo a double replacement reaction and form a white, solid substance
. Legal requirements, suppliers and distributors, competitors, and market profiles are contained in the _______ element of your business plan.
how many possible outcomes are there when flipping a coin 10 times?
5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand.
Which themes are found within Jack London’s “To Build a Fire”? Check all that apply. A. Belief in oneself is all that is needed to achieve a goal. B. Nature is
you move 25N object 5 meters. how much work did you do
How was Jane Addams a leader in the late 1800s and early 1900s