samij007
samij007 samij007
  • 27-01-2021
  • Mathematics
contestada

please i’m so confused please helpp

please im so confused please helpp class=

Respuesta :

snothing660 snothing660
  • 27-01-2021

Answer:

∠5=∠7=∠6=∠8=143°

∠4=∠2=∠1=37°

Step-by-step explanation:

∠4=180-∠6=180-143=37°

Answer Link

Otras preguntas

what is the factorization of the trinomial -x2 - 2x +48​
What are the Four Noble Truths?
Please help!! It's extra credit work, I'm on Spring break, and I'm tring to be on honor roll!!
The sum of an integer n and four is equal to the difference of ten and two.What is the value of n?
During the Cold War arms race, what prevented the United States and the Soviet Union from using nuclear weapons ?
What is the solution to the following system of linear equations? 4y − 36 = −12x 3x + y = −9 Select one: A. (-2, 3) B. (1, 5) C. no solution D. infinitely man
HELP PLS WILL MARK BRAINLIEST HAVE PICTURE BELOW Drag a figure into each blank space so that the two figures in the row match the description.
A square pyramid and a cone have the same base area. The volume of the cone is 100cm^3 , and the height of the cone is 15 cm. The height of the square pyramid i
what is the mrna of tacgggcctatacgctactactggatc​
Help!!! 20 points and explanation.