najubessi
najubessi najubessi
  • 27-10-2020
  • Mathematics
contestada

help help help help help

help help help help help class=

Respuesta :

samanthagarcia2021 samanthagarcia2021
  • 27-10-2020

Answer:

The answer is 20

Step-by-step explanation:

d=√ (-2-10)^2+(-6-10)^2

d=√ (-12)^2+(-16)^2

d=√ 144+256

d=20

Answer Link

Otras preguntas

help me slove these 3 problems
Please help and thank you
list the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
Which organization's member states were described as being behind the iron curtain after world war ii?
the perimeter of a triangle is 75 cm. The triangle is isosles now, but if its base were lenghthened by 2 cm and each leg were shortened by 7 cm, it would be equ
A scatter plot containing the point (5,9) has the regression equation yˆ=−x−3 . What is the residual when x = 5? Question 11 options: -17 9 17 0
If i have a 15 question test and the test is worth 25 points how many points is each question worth
When a culture values personal expression, independence, and privacy, the culture is collectivistic. a. True b. False?
Provide guidance on taking supplements for weight loss and/or hormone replacement and balance
Name the three bases (left to right) of the mrna codon on the ribosome. predict which trna anticodon will "dock" with the mrna codon.