beatrizwiggins beatrizwiggins

26-08-2020
History

contestada

What year did jesus die on the cross

Respuesta :

harleym2005 harleym2005

26-08-2020

Sometime between 30 and 33 A.D

Answer Link

Otras preguntas

How did the mexican-american war lead to greater sectionalism within the united states government?

you are in a marathon runner and need extra energy for tomorrow's race. How would pasta and pie help your body produce the energy it needs?

find missing number. show work. 120-35=100-?=60+?

please help me w/H.W please show the work

A teacher had 54 pencils gave p pencils to each of his s students. How many pencils does he have left?

How does an effective argumentative essay address counterclaim?

what is the mrna of tacgggcctatacgctactactggatc

How can molecules with polar bonds be non-polar?

if there are 13920 people in a stadiom ,what percent of the capacity is filled capacity is 16000

The names Jessica,Joshua,Jill,and Jimmy are written on slips of paper. The slips of paper are placed in a bag. One name is picked. Name an event that is impossi