zulmy87 zulmy87

28-11-2018
Biology

contestada

what factors regulate the opening and closing of guard cells?

Respuesta :

SmokeyRN SmokeyRN

28-11-2018

The guard cell synthesize glucose through photosynthesis in the presence of light. As glucose accumulates, osmotic pressure increases and this enables them to draw water from adjacent epidermal cells by osmosis. hope this helps

Answer Link

Otras preguntas

Help I'm confused! This is the beginning sequence of the first exon in the mRNA sequence: AUGAAGCUCUUUUGGUUGCUUUUCACCAUU Give the DNA/genomic sequence it was tr

10 out of 40 pencils in Ms. K's class are missing erasers. What percent of the pencils are missing erasers in Ms. K's class?

What is the product of the rational expressions shown below? Make sure your answer is in reduced form.

What do Sancho and Bolsa find in William's locker? a letter workout clothes money nothing

In this lab, 172.30.0.0 represents the __________ network and 10.20.1.0 represents the _________ network.

Given the base sequence AGCTTCGATCG on a DNA strand, what is the base sequence of the complementary DNA strand?

Which event prompted U.S. intervention in Latin America during the Cold War era? A. British claims to the Falkland Islands B. civil war in El Salvador C. Soviet

When Hitler assumed control of the Nazi party, he immediately began enforcing his personal nationalistic and racist views. set a suspicious fire that destroyed

Please help with the second part of my homework please? What context clues helped you determine the meaning of the idiom “(to) put a positive spin on”? A. “Cha

what element makes up 65% of body mass?