n4tf5vfsrg
n4tf5vfsrg
27-10-2022
Mathematics
contestada
QS = 3x-2 and RT = 48 -2x find x
Respuesta :
VER TODAS LAS RESPUESTAS ( 68+ )
Otras preguntas
write an equation of a line whose slope is -3 and whose y-intercept is 12
Find the common ratio for the follwing sequence. 27, 9, 3, 1, ... A. 3 B. - 1/3 C. -3 D 1/3There is a Picture too if you need it.
What is the measure of y?416NYXy = [?]Give your answer in simplest form.Enter
An object is held 33.5 cm from aconvex mirror. It creates a virtualimage of magnification 0.253.What is the image distance?(Mind your minus signs.)(Unit = cm)
Change any nucleotide between the Reading Frame (Between 'Start' and 'STOP' transcribing 5’ acgatgcattgtcccgcactgtaatat3’ 3’ tgctacgtaacagggcgtgactgcattata5’
What is 5,047.45676 times 234.37647364
The weight of an object in space is 500 N. Use ratios to obtain the objects new weight at:A. Half the distance from the centre of the EarthB. At 1/8 the distanc
Fluticasone is a medication that is used as nasal spray for allergies or taken orally for asthma. The molecular formula for Fluticasone is C22H27F3O4S.What is t
It takes Maria, traveling at 28mph, 45 minutes longer to go a certain distance than it takes Ricky traveling at 70mph. Find the distance traveled.
how do we do this one plkz ia sked braily already they got it wrong
